pygma

Ensembl ID:
ENSDARG00000055518
ZFIN ID:
ZDB-GENE-050522-482
Description:
glycogen phosphorylase, muscle form [Source:RefSeq peptide;Acc:NP_001018464]
Human Orthologue:
PYGM
Human Description:
phosphorylase, glycogen, muscle [Source:HGNC Symbol;Acc:9726]
Mouse Orthologue:
Pygm
Mouse Description:
muscle glycogen phosphorylase Gene [Source:MGI Symbol;Acc:MGI:97830]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31059 Nonsense Mutation detected in F1 DNA During 2017
sa39334 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077871 Nonsense 75 842 1 20
Genomic Location (Zv9):
Chromosome 21 (position 27839737)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28408648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTCAGAGACCACTTGGTAGGCAGATGGATCAGAACACAGCAGAGTTA[T/A]TACGAGAAAGACCCCAAAGTAAGTTCATGCATGTCGAGCTAAAGCAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077871 Essential Splice Site 657 842 17 20
Genomic Location (Zv9):
Chromosome 21 (position 27863255)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28432166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAGTCATGCGATTGTGAAAAATATCCCTATGGTTGTCTTTTTCTCTCA[G/A]CGATCCCCGCGGCCGACCTGTCCGAGCAGATCTCCACAGCCGGCACAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association study for serum urate concentrations and gout among African Americans identifies genomic risk loci and a novel URAT1 loss-of-function allele. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link