ENSDARG00000055506

Ensembl ID:
ENSDARG00000055506

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37818 Nonsense Mutation detected in F1 DNA During 2017
sa30033 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37818
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077866 Nonsense 20 233 2 5
Genomic Location (Zv9):
Chromosome 24 (position 6178820)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6066112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGCATGTACGGATTTTTACCCCTTAGATTTCACTTGCTGCAACCATG[G/T]AGGAGTTGTGTGAGGCAACAGAGTGTATGAGTGAATACCTGGCAAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077866 Nonsense 28 233 2 5
Genomic Location (Zv9):
Chromosome 24 (position 6178794)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6066086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGATTTCACTTGCTGCAACCATGGAGGAGTTGTGTGAGGCAACAGAGTG[T/A]ATGAGTGAATACCTGGCAAATGCAGGATGCCTTCGAGCTGTAAAATGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link