pdgfaa

Ensembl ID:
ENSDARG00000055505
ZFIN ID:
ZDB-GENE-030918-2
Description:
platelet-derived growth factor alpha a [Source:RefSeq peptide;Acc:NP_919407]
Human Orthologue:
PDGFA
Human Description:
platelet-derived growth factor alpha polypeptide [Source:HGNC Symbol;Acc:8799]
Mouse Orthologue:
Pdgfa
Mouse Description:
platelet derived growth factor, alpha Gene [Source:MGI Symbol;Acc:MGI:97527]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43858 Nonsense Mutation detected in F1 DNA During 2017
sa37527 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105088 Nonsense 31 194 2 6
Genomic Location (Zv9):
Chromosome 22 (position 26685959)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25984867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCATTTTTTTGTCTTTAACAGGAAGCACCAATTCCCCGAGAGCTGATT[G/T]AGAGACTCTCTAACAGTGAGATCCACAGCATCAGCGACCTCCAGAGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105088 Nonsense 143 194 4 6
Genomic Location (Zv9):
Chromosome 22 (position 26678713)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25977621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGATGCTCAGGCTGCTGCAACACCAGCAACATGCGCTGCCACCCGTCC[A/T]AAAAACACCACAGGAACGTGAAGGTGAAAATATACACATACACATCTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link