cic

Ensembl ID:
ENSDARG00000055502
ZFIN ID:
ZDB-GENE-030131-1966
Human Orthologue:
CIC
Human Description:
capicua homolog (Drosophila) [Source:HGNC Symbol;Acc:14214]
Mouse Orthologue:
Cic
Mouse Description:
capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11051 Nonsense Available for shipment Available now
sa4642 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7780 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14154 Nonsense Available for shipment Available now
sa13638 Nonsense Available for shipment Available now
sa13672 Nonsense Available for shipment Available now
sa6414 Nonsense Mutation detected in F1 DNA During 2014
sa12482 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11051
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077862 Nonsense 1435 2623 5 20
ENSDART00000140674 None None 1128 None 14
Genomic Location:
Chromosome 16 (position 12897576)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGAATCAGGACAACCGCACTGTCAGCAAAATACTCGGAGAGTGGTGGTA[C/A]GCCCTGGGACCCAAAGAAAAACAGAAATACCACGACCTCGCATTTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077862 Essential Splice Site 1496 2623 6 20
ENSDART00000140674 None None 1128 None 14
Genomic Location:
Chromosome 16 (position 12897864)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCCAGGAGGCAAAGACATCCGCGAGAGGAGCATGTCAGAAACCACAGG[T/C]GTGGAAYAGAGCAGCACGTGCCTCTTCAATTRRAATAGTTTCACAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077862 Essential Splice Site 1963 2623 11 20
ENSDART00000140674 Essential Splice Site 468 1128 5 14
Genomic Location:
Chromosome 16 (position 12907911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTAGYCCCTCCTCTTCCTGTTCAGAATGGAGCACAGGCAGGAAGCAAG[G/A]TGACTTCTTAGATTTCTGCAGCATTATCTTGRCAATAAGTATCCGATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077862 Nonsense 2022 2623 13 20
ENSDART00000140674 Nonsense 527 1128 7 14
ENSDART00000077862 Nonsense 2022 2623 13 20
ENSDART00000140674 Nonsense 527 1128 7 14
Genomic Location:
Chromosome 16 (position 12910483)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTSCCTAATCTGAACATCACGTTGTCTCCCACAGAATCACTTATGTA[C/T]AGTCCACTCCTGGGGTTCCTTCTCCTTTGCCATTAGTTCCCTCAACTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077862 Nonsense 2022 2623 13 20
ENSDART00000140674 Nonsense 527 1128 7 14
ENSDART00000077862 Nonsense 2022 2623 13 20
ENSDART00000140674 Nonsense 527 1128 7 14
Genomic Location:
Chromosome 16 (position 12910483)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTSCCTAATCTGAACATCACGTTGTCTCCCACAGAATCACTTATGTA[C/T]AGTCCACTCCTGGGGTTCCTTCTCCTTTGCCATTAGTTCCCTCAACTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077862 Nonsense 2551 2623 20 20
ENSDART00000140674 Nonsense 1056 1128 14 14
ENSDART00000077862 Nonsense 2551 2623 20 20
ENSDART00000140674 Nonsense 1056 1128 14 14
Genomic Location:
Chromosome 16 (position 12924900)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCGTTCCAGGCACGGTATGCTGATATCTTCCCAACAAAGGTGTGTTTA[C/A]AGCTCAAGAWTCGAGAGGTCCGGCARAAGATCATGCAAAMGGCAGCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6414
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077862 Nonsense 2551 2623 20 20
ENSDART00000140674 Nonsense 1056 1128 14 14
ENSDART00000077862 Nonsense 2551 2623 20 20
ENSDART00000140674 Nonsense 1056 1128 14 14
Genomic Location:
Chromosome 16 (position 12924900)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCGTTCCAGGCACGGTATGCTGATATCTTCCCAACAAAGGTGTGTTTA[C/T]AGCTCAAGAWTCGAGAGGTCCGGCARAAGATCATGCAAAMGGCAGCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12482
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077862 Nonsense 2601 2623 20 20
ENSDART00000140674 Nonsense 1106 1128 14 14
Genomic Location:
Chromosome 16 (position 12925050)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGACAMTGGACCCAGCTTTAGGGGCAGACCCTCTGGAGAAGGAGGTT[G/T]AGCGAGAGGGTGAACAACACAGCCCAGAGGAGCCTAGAAACGCTGGCGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vfcm0tfm