si:ch1073-184j22.1

Ensembl ID:
ENSDARG00000055498
ZFIN ID:
ZDB-GENE-081104-74
Description:
Novel protein similar to family with sequence similarity 132 [Source:UniProtKB/TrEMBL;Acc:B8JLI7]
Human Orthologue:
FAM132B
Human Description:
family with sequence similarity 132, member B [Source:HGNC Symbol;Acc:26727]
Mouse Orthologue:
Fam132b
Mouse Description:
family with sequence similarity 132, member B Gene [Source:MGI Symbol;Acc:MGI:3606476]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39756 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077861 Nonsense 197 294 5 8
ENSDART00000139762 Nonsense 111 208 3 6
ENSDART00000146906 Nonsense 57 103 2 5
Genomic Location (Zv9):
Chromosome 2 (position 5024247)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5469975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTAACATCAGCAGCGGCCGCTATACGGCTCCAGTGTCTGGCTTCTAT[C/T]AGCTCTCAGCTAATCTGCTGCTAGGTATGGGTTTTTCTGGACGGCAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link