hic1

Ensembl ID:
ENSDARG00000055493
ZFIN ID:
ZDB-GENE-040713-2
Description:
hypermethylated in cancer 1 protein [Source:RefSeq peptide;Acc:NP_001002314]
Human Orthologue:
HIC1
Human Description:
hypermethylated in cancer 1 [Source:HGNC Symbol;Acc:4909]
Mouse Orthologue:
Hic1
Mouse Description:
hypermethylated in cancer 1 Gene [Source:MGI Symbol;Acc:MGI:1338010]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19118 Nonsense Mutation detected in F1 DNA During 2014
sa10158 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077853 Nonsense 314 737 2 2
ENSDART00000148190 None None 195 None 2
ENSDART00000077853 Nonsense 314 737 2 2
ENSDART00000148190 None None 195 None 2
Genomic Location:
Chromosome 15 (position 25023700)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACCATCCACTTGCACCCAATCTTCCCCATCTGCATCGTTCTCAGGGA[C/T]AGGAACAGTACCCCTGCCCTCCAAGCCCAGAACCCATAGAGGACACCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077853 Nonsense 314 737 2 2
ENSDART00000148190 None None 195 None 2
ENSDART00000077853 Nonsense 314 737 2 2
ENSDART00000148190 None None 195 None 2
Genomic Location:
Chromosome 15 (position 25023700)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACCATCCACTTGCACCCAATCTTCCCCATCTGCATCGTTCTCAGGGA[C/T]AGGAACAGTACCCCTGCCCTCCAAGCCCAGAACCCATAGAGGACACCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ki63r18o