hic1

Ensembl ID:
ENSDARG00000055493
ZFIN ID:
ZDB-GENE-040713-2
Description:
hypermethylated in cancer 1 protein [Source:RefSeq peptide;Acc:NP_001002314]
Human Orthologue:
HIC1
Human Description:
hypermethylated in cancer 1 [Source:HGNC Symbol;Acc:4909]
Mouse Orthologue:
Hic1
Mouse Description:
hypermethylated in cancer 1 Gene [Source:MGI Symbol;Acc:MGI:1338010]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45540 Nonsense Mutation detected in F1 DNA During 2018
sa19118 Nonsense Mutation detected in F1 DNA During 2018
sa10158 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077853 Nonsense 22 737 2 2
ENSDART00000148190 Nonsense 45 194 2 2
Genomic Location (Zv9):
Chromosome 15 (position 25022824)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25752752
GRCz11 15 25688017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAGTTCCAAGTCATGCTAGGCACCTCCTCTTGCAATTGAACACACAA[C/T]GAACCAAAGGCTTCTTGTGTGATGTTATTATCGTGGTGCAGAATGCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077853 Nonsense 314 737 2 2
ENSDART00000148190   None 195 None 2
ENSDART00000077853 Nonsense 314 737 2 2
ENSDART00000148190   None 195 None 2
Genomic Location (Zv9):
Chromosome 15 (position 25023700)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25753628
GRCz11 15 25688893
KASP Assay ID:
2260-8549.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACCATCCACTTGCACCCAATCTTCCCCATCTGCATCGTTCTCAGGGA[C/T]AGGAACAGTACCCCTGCCCTCCAAGCCCAGAACCCATAGAGGACACCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077853 Nonsense 314 737 2 2
ENSDART00000148190   None 195 None 2
ENSDART00000077853 Nonsense 314 737 2 2
ENSDART00000148190   None 195 None 2
Genomic Location (Zv9):
Chromosome 15 (position 25023700)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25753628
GRCz11 15 25688893
KASP Assay ID:
2260-8549.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACCATCCACTTGCACCCAATCTTCCCCATCTGCATCGTTCTCAGGGA[C/T]AGGAACAGTACCCCTGCCCTCCAAGCCCAGAACCCATAGAGGACACCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link