or137-5

Ensembl ID:
ENSDARG00000055485
ZFIN ID:
ZDB-GENE-070806-26

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26840 Nonsense Mutation detected in F1 DNA During 2017
sa26841 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077848 Nonsense 79 310 1 1
Genomic Location (Zv9):
Chromosome 6 (position 52845043)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52891390
GRCz10 6 52894048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGATATGCTCATGGTTTTTGTAAGTGTGTCTCTTTCTGTGATGGCTTA[T/A]GCATGGCGAAATGTACCTATCCCGTTTTGTGTTGTACTACTGATAATAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077848 Nonsense 298 310 1 1
Genomic Location (Zv9):
Chromosome 6 (position 52845700)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52894705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTTCGAGATAAAGTGTTTTATAGTCACATGAAAGGCATTGTTGCATG[T/A]AAATTAGTTATTGTAAAGGTTGAATCAACCAAACAATAAGCAAAAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link