dexi

Ensembl ID:
ENSDARG00000055474
ZFIN ID:
ZDB-GENE-040808-20
Description:
Dexamethasone-induced protein homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6AXJ3]
Human Orthologue:
DEXI
Human Description:
Dexi homolog (mouse) [Source:HGNC Symbol;Acc:13267]
Mouse Orthologue:
Dexi
Mouse Description:
dexamethasone-induced transcript Gene [Source:MGI Symbol;Acc:MGI:1926236]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16361 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16361
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077835 Nonsense 24 89 1 2
Genomic Location (Zv9):
Chromosome 3 (position 26112358)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26774614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTAGATTCAGTGGAATCGCTAATCGACGAGCTTCCATATATGTATTA[T/A]CTCGGCCTGTTTTTTGTCAATGTCTTAATCCTCTACTATGCCTTTTTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link