cdc16

Ensembl ID:
ENSDARG00000055470
ZFIN ID:
ZDB-GENE-051113-132
Description:
cell division cycle protein 16 homolog [Source:RefSeq peptide;Acc:NP_001032466]
Human Orthologue:
CDC16
Human Description:
cell division cycle 16 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:1720]
Mouse Orthologue:
Cdc16
Mouse Description:
CDC16 cell division cycle 16 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1917207]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34691 Nonsense Mutation detected in F1 DNA During 2017
sa27441 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077814 Nonsense 439 616 14 18
ENSDART00000137888   None 162 None 8
Genomic Location (Zv9):
Chromosome 9 (position 35900143)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35119654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGAAGTTGTTTCTAGATGCTATGGAGAAGATCAAAGCCATTGGAAAC[G/T]AGGTAACCGTCCACTCCATTAGGACGTAACTTTATGATAAAACAATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27441
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077814 Nonsense 587 616 18 18
ENSDART00000137888   None 162 None 8
Genomic Location (Zv9):
Chromosome 9 (position 35891620)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35111131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAAGAAGTAAACGTGTGCATAGAAACGCCATCATTCAATGCGGACAAA[C/T]AAACCGATGCTTTTCAGCGCTTCCTCTTAGAATGTGACATGCATGAGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link