si:ch211-250g4.1

Ensembl ID:
ENSDARG00000055459
ZFIN ID:
ZDB-GENE-060503-413
Description:
disks large-associated protein 3 [Source:RefSeq peptide;Acc:NP_001038179]
Human Orthologue:
DLGAP3
Human Description:
discs, large (Drosophila) homolog-associated protein 3 [Source:HGNC Symbol;Acc:30368]
Mouse Orthologue:
Dlgap3
Mouse Description:
discs, large (Drosophila) homolog-associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:3039563]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23571 Nonsense Available for shipment Available now
sa13263 Nonsense Available for shipment Available now
sa7460 Missense Mutation detected in F1 DNA During 2017
sa23572 Nonsense Available for shipment Available now
sa7461 Missense Mutation detected in F1 DNA During 2017
sa43323 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Nonsense 149 1059 1 10
Genomic Location (Zv9):
Chromosome 19 (position 39007951)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37871934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCGGAGCGAGAGTCCAAGTCGCATACGGCATTTGGTAAACTCTGTC[C/T]AGCGTCTTTTCGCCAAGTCTCATTCTCTAGAAGCACCCTCTAAACGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Nonsense 232 1059 1 10
Genomic Location (Zv9):
Chromosome 19 (position 39008202)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37872185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCGCCATGAGTCTCGAAGTTCCCGTMACCGCAGTAAAACAGCCGGCTG[G/A]TGGAGCTCTGATGACAACCTGGACAGCGACAGCAGCTTTCWGGTGGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7460
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Missense 246 1059 1 10
Genomic Location (Zv9):
Chromosome 19 (position 39008243)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37872226
KASP Assay ID:
554-4277.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCGGCTGGTGGAGCTCTGATGACAACCTGGACAGCGACAGCAGCTTTC[T/A]GGTGGGTGCAGGCAGGGGTGTTCGAGGTTATCCCACCGGACACGAGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Nonsense 274 1059 1 10
Genomic Location (Zv9):
Chromosome 19 (position 39008326)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37872309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCGGACACGAGACCCTGGATGCTGCCATTCAGGAACTTACCTTAAGG[A/T]AATCTAAAGGTCCACCTCCTGGAGAGTGCTTGGCTTGCACCAATATAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Missense 421 1059 2 10
Genomic Location (Zv9):
Chromosome 19 (position 39026779)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37890762
KASP Assay ID:
554-4378.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTCATTGCCCAGAGAGAAGCCTTCCGCCGCTCCGTCAGCATGGATCAA[C/T]GCTCCTCCACAACATCCAAGTCAGTCGTCAATTAATTTTAARTTTGTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Nonsense 850 1059 7 10
Genomic Location (Zv9):
Chromosome 19 (position 39037818)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37901801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAGGGCCCCCGGAGCCTCCCAGATTCAGGCCGAGCCTCGCCTTGCTTA[C/T]GAGATGGAGAGTTCTTCCTCCGGCTCCTGCAGACAGAGGTGGAGAGGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link