si:busm1-194e12.11

Ensembl ID:
ENSDARG00000055441
ZFIN IDs:
ZDB-GENE-030616-318, ZDB-GENE-030616-505
Description:
hypothetical protein LOC368614 [Source:RefSeq peptide;Acc:NP_001007206]
Human Orthologues:
HLA-DMA, HLA-DMB, HLA-DOA, HLA-DPA1, HLA-DQA1, HLA-DQA2, HLA-DRA, XXbac-BPG181M17.5
Human Descriptions:
major histocompatibility complex, class II, DM alpha [Source:HGNC Symbol;Acc:4934]
major histocompatibility complex, class II, DM beta [Source:HGNC Symbol;Acc:4935]
Major histocompatibility complex, class II, DM beta [Source:UniProtKB/TrEMBL;Acc:A2AAT6]
major histocompatibility complex, class II, DO alpha [Source:HGNC Symbol;Acc:4936]
major histocompatibility complex, class II, DP alpha 1 [Source:HGNC Symbol;Acc:4938]
major histocompatibility complex, class II, DQ alpha 1 [Source:HGNC Symbol;Acc:4942]
major histocompatibility complex, class II, DQ alpha 2 [Source:HGNC Symbol;Acc:4943]
major histocompatibility complex, class II, DR alpha [Source:HGNC Symbol;Acc:4947]
Mouse Orthologues:
H2-Aa, H2-DMa, H2-DMb1, H2-DMb2, H2-Oa
Mouse Descriptions:
histocompatibility 2, class II antigen A, alpha Gene [Source:MGI Symbol;Acc:MGI:95895]
histocompatibility 2, class II, locus DMa Gene [Source:MGI Symbol;Acc:MGI:95921]
histocompatibility 2, class II, locus Mb1 Gene [Source:MGI Symbol;Acc:MGI:95922]
histocompatibility 2, class II, locus Mb2 Gene [Source:MGI Symbol;Acc:MGI:95923]
histocompatibility 2, O region alpha locus Gene [Source:MGI Symbol;Acc:MGI:95924]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34448 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077794 Nonsense 130 236 3 4
Genomic Location (Zv9):
Chromosome 8 (position 36284170)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 35352674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGAGCTGGGTGTTCAAAACACCCTTGTCTGTCATGTGACTGGCTTCTA[T/A]CCTCCATCTGTCAGTGTCTCATGGACTAAGAATAATATTAATGTGTCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link