si:dkey-177p2.14

Ensembl ID:
ENSDARG00000055426
ZFIN ID:
ZDB-GENE-041001-119
Description:
RWD domain-containing protein 2B [Source:RefSeq peptide;Acc:NP_001068583]
Human Orthologue:
RWDD2B
Human Description:
RWD domain containing 2B [Source:HGNC Symbol;Acc:1302]
Mouse Orthologue:
Rwdd2b
Mouse Description:
RWD domain containing 2B Gene [Source:MGI Symbol;Acc:MGI:1858215]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39281 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077782 Nonsense 166 289 4 5
ENSDART00000138249 Nonsense 162 285 3 4
Genomic Location (Zv9):
Chromosome 20 (position 26942920)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27014223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCAAAAACAACATTCAGTAGACTCTGGATCTACAGCCATCATATCTA[C/A]AATAAGATCAAGAGGAAGAACATTCTGGAATGGGCAAAGGAGCTAAACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link