bambia

Ensembl ID:
ENSDARG00000055381
ZFIN ID:
ZDB-GENE-010416-1
Description:
BMP and activin membrane-bound inhibitor homolog [Source:RefSeq peptide;Acc:NP_571859]
Human Orthologue:
BAMBI
Human Description:
BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) [Source:HGNC Symbol;Acc:30251]
Mouse Orthologue:
Bambi
Mouse Description:
BMP and activin membrane-bound inhibitor, homolog (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35297 Nonsense Mutation detected in F1 DNA During 2017
sa2630 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa35297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077732 Nonsense 180 258 3 3
Genomic Location (Zv9):
Chromosome 12 (position 24852112)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23308452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTGCGAATGCTCCGTAGCGAAAACAAGCGTCTCCAGGCACAGCGCCAG[C/T]AGATGCTTTCTCGCCTGCATTACAGCTTTCACGGACACCACCATGCCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2630
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077732 Nonsense 203 258 3 3
Genomic Location (Zv9):
Chromosome 12 (position 24852182)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23308522
KASP Assay ID:
554-2559.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACAGCTTTCACGGACACCACCATGCCAAGAAAGGCCACGTGGCTAAGT[T/A]GGAYTTGGAGTGTATGGTGCCGGTAACGGGACATGAGAACTGTTGTCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link