gnb5b

Ensembl ID:
ENSDARG00000055377
ZFIN ID:
ZDB-GENE-040426-1712
Description:
guanine nucleotide-binding protein subunit beta-5 [Source:RefSeq peptide;Acc:NP_957040]
Human Orthologue:
GNB5
Human Description:
guanine nucleotide binding protein (G protein), beta 5 [Source:HGNC Symbol;Acc:4401]
Mouse Orthologue:
Gnb5
Mouse Description:
guanine nucleotide binding protein (G protein), beta 5 Gene [Source:MGI Symbol;Acc:MGI:101848]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10693 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077724 Nonsense 107 395 4 13
ENSDART00000142390 Nonsense 99 212 2 6
Genomic Location:
Chromosome 18 (position 37514252)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGTCAGTTTGTCATGAAGACCCGTCGAACGTTAAAAGGGCATGGAAAT[A/T]AAGTKCTGTGTATGGACTGGTGCCGGGACAAGAGAAGAATCGTCAGCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4tdexygn