sema3fb

Ensembl ID:
ENSDARG00000055373
ZFIN ID:
ZDB-GENE-050513-2
Description:
Semaphorin 3Fb [Source:UniProtKB/TrEMBL;Acc:Q5ID23]
Human Orthologue:
SEMA3F
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F [Source:HGNC
Mouse Orthologue:
Sema3f
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F Gene [Source:

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35134 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14466 Nonsense Available for shipment Available now
sa38853 Nonsense Mutation detected in F1 DNA During 2017
sa24893 Nonsense Mutation detected in F1 DNA During 2017
sa13129 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031441 Essential Splice Site 37 787 1 18
ENSDART00000077717   None 743 None 19
ENSDART00000139712   None 688 None 16
Genomic Location (Zv9):
Chromosome 11 (position 36410388)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35307616
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGGCAATGAACCTCAAAATGCCCCGCGGGTCTTCTTGTCCTTCAAAG[G/A]TAAGAGAGCATTCAGTTCTGGTTTCTCTTGGTTTGCTCTTGCGTTCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031441 Nonsense 477 787 12 18
ENSDART00000077717 Nonsense 429 743 13 19
ENSDART00000139712 Nonsense 378 688 10 16
Genomic Location (Zv9):
Chromosome 11 (position 36305780)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35203008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTCACAACCWTCACTGTGGATCAGGTCACAGCGGCCGACGGAAACTA[T/G]GAGGTGCTSTTCCTGGGAACAGGTGAGTTTCATGATTTTTTTTTNNNCATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031441 Nonsense 532 787 15 18
ENSDART00000077717 Nonsense 484 743 16 19
ENSDART00000139712 Nonsense 433 688 13 16
Genomic Location (Zv9):
Chromosome 11 (position 36298413)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35195641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTAATGTTTAAATAACTTTTTAAATTCTTTTTGCAGCAACAACTGTA[T/A]GTGGCCTCTGCGGTGGGAGTGACGCATATGGCTCTGCACCGCTGTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031441 Nonsense 579 787 15 18
ENSDART00000077717 Nonsense 531 743 16 19
ENSDART00000139712 Nonsense 480 688 13 16
Genomic Location (Zv9):
Chromosome 11 (position 36298274)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35195502
KASP Assay ID:
554-7331.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCTATTGTGCATGGGACGGCAAATCCTGCTCTAGATACTCAGCCTCG[C/T]AGAAGAGGTAAATATGCTAAAGCATGCAAATAATGTTCTTAACAAAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031441 Essential Splice Site 649 787 None 18
ENSDART00000077717 Essential Splice Site 605 743 None 19
ENSDART00000139712 Essential Splice Site 550 688 None 16
Genomic Location (Zv9):
Chromosome 11 (position 36292783)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35190011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTGGCAATAATRCTWGTRAAAGTAATTGCTCCTGTGTGTGTTTGTGC[A/G]GRTCCGCAGTGATGGCCGTGTGCTGAAGWCGGATCAAGGTTTGCTTCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link