leo1

Ensembl ID:
ENSDARG00000055357
ZFIN ID:
ZDB-GENE-040426-2435
Description:
RNA polymerase-associated protein LEO1 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYV9]
Human Orthologue:
LEO1
Human Description:
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:3040
Mouse Orthologue:
Leo1
Mouse Description:
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2979 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2979
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077694 Nonsense 118 696 2 11
ENSDART00000077694 Nonsense 118 696 2 11
Genomic Location:
Chromosome 18 (position 37756519)
KASP Assay ID:
554-3266.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTGGCAGYAGGCACAGTGGCAGCCAGCACAGCGGGAGCCAATCAGAG[C/T]GATCGGGCAACCAATCAGACGCCACCATGCACTCTGACAATGAACACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9jh5831v