leo1

Ensembl ID:
ENSDARG00000055357
ZFIN ID:
ZDB-GENE-040426-2435
Description:
RNA polymerase-associated protein LEO1 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYV9]
Human Orthologue:
LEO1
Human Description:
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:3040
Mouse Orthologue:
Leo1
Mouse Description:
Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29073 Nonsense Mutation detected in F1 DNA During 2016
sa2979 Nonsense F2 line generated During 2016
sa43155 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa29073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077694 Nonsense 50 696 2 11
Genomic Location (Zv9):
Chromosome 18 (position 37756723)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39338426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCAAGATCTGCCAGCAACGCTTCTGGAAGCGAGAGTGCTCAGAGTGAC[C/T]GAGATCATGATGATGATGAAGATGAAGATGGCGGAAAGCCTAGCAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2979
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077694 Nonsense 118 696 2 11
ENSDART00000077694 Nonsense 118 696 2 11
Genomic Location (Zv9):
Chromosome 18 (position 37756519)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39338222
KASP Assay ID:
554-3266.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTGGCAGYAGGCACAGTGGCAGCCAGCACAGCGGGAGCCAATCAGAG[C/T]GATCGGGCAACCAATCAGACGCCACCATGCACTCTGACAATGAACACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077694 Nonsense 211 696 2 11
Genomic Location (Zv9):
Chromosome 18 (position 37756240)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39337943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAACCCCACATACAGATGGAGAGGGGTCAGGGAAAGATGCCCATTCT[G/T]GAGATGAGAAGTGGGGTGGAGATGGAAAAAGTGACCAGTCGGAGGACGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link