pknox2

Ensembl ID:
ENSDARG00000055349
ZFIN ID:
ZDB-GENE-031118-112
Description:
pbx/knotted 1 homeobox 2 [Source:RefSeq peptide;Acc:NP_705940]
Human Orthologue:
PKNOX2
Human Description:
PBX/knotted 1 homeobox 2 [Source:HGNC Symbol;Acc:16714]
Mouse Orthologue:
Pknox2
Mouse Description:
Pbx/knotted 1 homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2445415]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17092 Essential Splice Site Available for shipment Available now
sa17850 Nonsense Available for shipment Available now
sa466 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004553 Essential Splice Site 75 474 None 11
ENSDART00000134866 Essential Splice Site 75 474 None 12

The following transcripts of ENSDARG00000055349 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 32079117)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31180466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTGACCCTCAAGCCCAACTGGAGTCKGACAAACGAGCCGTTTACAGG[T/G]CAGTGCAACGGATATTTACWAARATTTCAAAACTTGTGCTCGAGTTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004553 Nonsense 244 474 7 11
ENSDART00000134866 Nonsense 244 474 8 12

The following transcripts of ENSDARG00000055349 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 32043860)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31145209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTAAAGTGTGTGATAACCCGACTGATTCCCACAGGTGGGACGCTGTA[T/A]CAGCCRGTGGCAATGGTTACCTCACAGGGGCAGGTGTTAACACAGGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004553 Nonsense 292 474 8 11
ENSDART00000134866 Nonsense 292 474 9 12

The following transcripts of ENSDARG00000055349 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 32039468)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31140817
KASP Assay ID:
554-0198.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACTTGTCCTCACTCTTGGATGGCGATGACAAGAAATCAAAAAACAAA[A/T]GAGGCGTCCTTCCCAAACATGCCACAAACATTATGCGTTCCTGGCTCTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link