mipep

Ensembl ID:
ENSDARG00000055344
ZFIN ID:
ZDB-GENE-060503-662
Human Orthologue:
MIPEP
Human Description:
mitochondrial intermediate peptidase [Source:HGNC Symbol;Acc:7104]
Mouse Orthologue:
Mipep
Mouse Description:
mitochondrial intermediate peptidase Gene [Source:MGI Symbol;Acc:MGI:1917728]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35809 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077660 Essential Splice Site 605 702 16 19
ENSDART00000142022   None 98 None 3
Genomic Location (Zv9):
Chromosome 15 (position 8281828)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 8231335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATAGACTTGCAGAAGAAGTATTATGGTCTGCCATATGTCGCCAACACAG[T/C]GAGTGTGCTTCATTTAAAATCATACATAAATATTTAATTGTATTCTTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lung cancer: A genome-wide association study identifies two new lung cancer susceptibility loci at 13q12.12 and 22q12.2 in Han Chinese. (View Study)
  • Myopia (pathological): Genetic variants at 13q12.12 are associated with high myopia in the Han Chinese population. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link