
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mipep
- Ensembl ID:
- ENSDARG00000055344
- ZFIN ID:
- ZDB-GENE-060503-662
- Human Orthologue:
- MIPEP
- Human Description:
- mitochondrial intermediate peptidase [Source:HGNC Symbol;Acc:7104]
- Mouse Orthologue:
- Mipep
- Mouse Description:
- mitochondrial intermediate peptidase Gene [Source:MGI Symbol;Acc:MGI:1917728]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35809 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35809
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077660 | Essential Splice Site | 605 | 702 | 16 | 19 |
ENSDART00000142022 | None | 98 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 15 (position 8281828)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 8231335 GRCz11 15 8207406 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATAGACTTGCAGAAGAAGTATTATGGTCTGCCATATGTCGCCAACACAG[T/C]GAGTGTGCTTCATTTAAAATCATACATAAATATTTAATTGTATTCTTTAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Lung cancer: A genome-wide association study identifies two new lung cancer susceptibility loci at 13q12.12 and 22q12.2 in Han Chinese. (View Study)
- Myopia (pathological): Genetic variants at 13q12.12 are associated with high myopia in the Han Chinese population. (View Study)
- Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: