mark1

Ensembl ID:
ENSDARG00000055343
ZFIN ID:
ZDB-GENE-070626-2
Description:
serine/threonine-protein kinase MARK1 [Source:RefSeq peptide;Acc:NP_001107948]
Human Orthologue:
MARK1
Human Description:
MAP/microtubule affinity-regulating kinase 1 [Source:HGNC Symbol;Acc:6896]
Mouse Orthologue:
Mark1
Mouse Description:
MAP/microtubule affinity-regulating kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2664902]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25186 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013234 Nonsense 14 325 1 9
Genomic Location:
Chromosome 22 (position 41764745)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTCTCTTCTCCCACAGCTCTTTCGTGAAGTGAGGATTATGAAGGTCT[T/G]AAATCATCCTAATATAGGTAAGGAATCATCCTGATATCCATTTTACATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dc595ebr