LOC100005785

Ensembl ID:
ENSDARG00000055334

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16276 Nonsense Available for shipment Available now
sa31066 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106092 Nonsense 43 215 1 3
Genomic Location (Zv9):
Chromosome 22 (position 8726137)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 8671907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCTCGAATAGCTGAAGCCAGCAAACTCACACAAACCAACTCCACATA[T/G]GMTGGTCCAGATGGRAGATTCAGAGATAGACTGTATCTGGATGAGATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106092 Nonsense 213 215 3 3
Genomic Location (Zv9):
Chromosome 22 (position 8727364)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 8673134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAAATCACACCAGCGCTATGAACCCAGCAAAAGAATGAGCTCCAGATA[T/A]GTTTGCTGAATGTTACTGGCATATTCTTGACAAAATAAATCGATATATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link