LOC567540

Ensembl ID:
ENSDARG00000055317
Human Orthologue:
C1QL4
Human Description:
complement component 1, q subcomponent-like 4 [Source:HGNC Symbol;Acc:31416]
Mouse Orthologue:
C1ql4
Mouse Description:
complement component 1, q subcomponent-like 4 Gene [Source:MGI Symbol;Acc:MGI:3579909]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40751 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40751
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067063 Nonsense 141 240 1 2
Genomic Location (Zv9):
Chromosome 6 (position 39744753)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39816353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGAGGTACTCAAGTTTGATGATGTGGTGACAAATGTTGGGAATTACTA[T/G]GAGCCTACCACAGGCAAGTTCACCTGCCCTCTTCCTGGAATCTACTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link