c10orf119

Ensembl ID:
ENSDARG00000055314
ZFIN ID:
ZDB-GENE-030131-9676
Description:
c10orf119 homolog [Source:RefSeq peptide;Acc:NP_997743]
Human Orthologue:
C10orf119
Human Description:
chromosome 10 open reading frame 119 [Source:HGNC Symbol;Acc:25782]
Mouse Orthologue:
1110007A13Rik
Mouse Description:
RIKEN cDNA 1110007A13 gene Gene [Source:MGI Symbol;Acc:MGI:1920977]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38943 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22305 Nonsense Available for shipment Available now
sa38942 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077655 Essential Splice Site 20 631 2 16
ENSDART00000135788 Essential Splice Site 20 631 2 16

The following transcripts of ENSDARG00000055314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 25772411)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25418071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTAATTATATTGTAAATAACCTACGTTTTTTTGCTTTATGCTCCCACA[G/T]CCCAGAGTAACTCCAGTCCAGACTGGGAGAAGAAAGTTGTGGAGTATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077655 Nonsense 21 631 2 16
ENSDART00000135788 Nonsense 21 631 2 16

The following transcripts of ENSDARG00000055314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 25772408)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25418068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTATATTGTAAATAACCTACGTTTTTTTGCTTTATGCTCCCACAGCC[C/T]AGAGTAACTCCAGTCCAGACTGGGAGAAGAAAGTTGTGGAGTATTTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077655 Essential Splice Site 461 631 12 16
ENSDART00000135788 Essential Splice Site 461 631 12 16

The following transcripts of ENSDARG00000055314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 25766641)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25412301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTCTGGATGAGACGCAGTTGGAGCAGGGCCAACTGGACTCCACAGG[T/C]GAGAGCACTGATTACCGCAGAATACAGTAGGAGTCCAAACGTCTGAGGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link