c10orf119

Ensembl ID:
ENSDARG00000055314
ZFIN ID:
ZDB-GENE-030131-9676
Description:
c10orf119 homolog [Source:RefSeq peptide;Acc:NP_997743]
Human Orthologue:
C10orf119
Human Description:
chromosome 10 open reading frame 119 [Source:HGNC Symbol;Acc:25782]
Mouse Orthologue:
1110007A13Rik
Mouse Description:
RIKEN cDNA 1110007A13 gene Gene [Source:MGI Symbol;Acc:MGI:1920977]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22305 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077655 Nonsense 21 631 2 16
ENSDART00000135788 Nonsense 21 631 2 16

The following transcripts of ENSDARG00000055314 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 25772408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTATATTGTAAATAACCTACGTTTTTTTGCTTTATGCTCCCACAGCC[C/T]AGAGTAACTCCAGTCCAGACTGGGAGAAGAAAGTTGTGGAGTATTTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qvg5m3pf