ret1

Ensembl ID:
ENSDARG00000055305
ZFIN ID:
ZDB-GENE-980526-307
Description:
proto-oncogene tyrosine-protein kinase receptor Ret [Source:RefSeq peptide;Acc:NP_858048]
Human Orthologue:
RET
Human Description:
ret proto-oncogene [Source:HGNC Symbol;Acc:9967]
Mouse Orthologue:
Ret
Mouse Description:
ret proto-oncogene Gene [Source:MGI Symbol;Acc:MGI:97902]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu2846 Nonsense Confirmed mutation in F2 line Unknown
sa15240 Nonsense Available for shipment Available now
sa22307 Nonsense Mutation detected in F1 DNA During 2014
sa2684 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu2846
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077627 Nonsense 229 1106 4 20
ENSDART00000139237 Nonsense 211 1046 3 18
Genomic Location:
Chromosome 13 (position 25824425)
KASP Assay ID:
554-0012.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAAGTGGACCGCGAGGAGAAGGAAGTGTATCATCTGGATATAGTCTG[T/A]ATGGTACGAACAGAAAGAAATCTGGAGGAGGTCTTCAGATCTTTACATGT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
ventral mandibular arch
ZFA:0001273
quality
PATO:0000001
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
25:32079501-32079818 32079818 1 1.96 × 10-07 -1.7 -2 tnni2a.1 ENSDARG00000045592
8:5862381-5863000 5862381 -1 4.48 × 10-06 -1.2 -2 diabloa ENSDARG00000035323
6:40676532-40677100 40676532 -1 1.43 × 10-05 -1.6 100 myhb ENSDARG00000001993
16:56119901-56120100 56122673 1 6.74 × 10-05 -1.0 -1 fabp10a ENSDARG00000038439
5:46432652-46433000 46432652 -1 2.64 × 10-04 1.7 -6 fbp2 ENSDARG00000012366

Mutation Details

Allele Name:
sa15240
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077627 Nonsense 760 1106 13 20
ENSDART00000139237 Nonsense 742 1046 12 18
Genomic Location:
Chromosome 13 (position 25814990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATKACTYTAACCATTMATTTTTTCACCACAGAAAATGCRTCTCACAGC[G/T]AGCTTCGAGAYCTCCTSTCAGAGTTCACATTGCTYAAGCAGGTTAATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077627 Nonsense 800 1106 14 20
ENSDART00000139237 Nonsense 782 1046 13 18
Genomic Location:
Chromosome 13 (position 25814781)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTTATGTTAATGTGTTCAGGTCCATTATACTTAATTGTTGAATACGCC[A/T]AGTATGGTTCACTACGTAACTTCCTGAGAGAGAGCCGCAAAGTTGGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077627 Nonsense 849 1106 14 20
ENSDART00000139237 Nonsense 831 1046 13 18
Genomic Location:
Chromosome 13 (position 25814634)
KASP Assay ID:
554-2592.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCAGACGAGAGAGCTCTGACCATGGGCGACCTGATCTCGTTCGCCTGG[C/T]AGATCTCTAGAGGAATGCAATACCTAGCTGAGATGAAGGTATGCCAGTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6rgv0eq3