grid2

Ensembl ID:
ENSDARG00000055302
ZFIN ID:
ZDB-GENE-040913-1
Description:
Glutamate receptor delta-2 subunit [Source:UniProtKB/Swiss-Prot;Acc:Q68Y21]
Human Orthologue:
GRID2
Human Description:
glutamate receptor, ionotropic, delta 2 [Source:HGNC Symbol;Acc:4576]
Mouse Orthologue:
Grid2
Mouse Description:
glutamate receptor, ionotropic, delta 2 Gene [Source:MGI Symbol;Acc:MGI:95813]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2468 Nonsense Mutation detected in F1 DNA During 2014
sa18921 Nonsense Mutation detected in F1 DNA During 2014
sa8370 Nonsense Mutation detected in F1 DNA During 2014
sa10692 Nonsense Available for shipment Available now
sa9218 Nonsense Mutation detected in F1 DNA During 2014
sa18043 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
Genomic Location:
Chromosome 8 (position 30115407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTSCAAGTGGTGATGGAGTACACTTGGCAGAAGTTCRTTATCTTCTA[T/A]GACACAGACTATGGTGAGTAGTTTCAATTTACTGATGGCTGTAGCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
Genomic Location:
Chromosome 8 (position 30115407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCCAAGTGGTGATGGAGTACACTTGGCAGAAGTTCATTATCTTCTA[T/A]GACACAGACTATGGTGAGTAGTTTCAATTTACTGATGGCTGTAGCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
Genomic Location:
Chromosome 8 (position 30115407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTSCAAGTGGTGATGGAGTACACTTGGCAGAAGTTCRTTATCTTCTA[T/A]GACACAGACTATGGTGAGTAGTTTCAATTTACTGATGGCTGTAGCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Nonsense 620 928 11 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 701 1009 13 16
Genomic Location:
Chromosome 8 (position 30339981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTGCCGTCTATGACCAGGTTCGCAGTAAAGGAATGAACCCTTTCGAA[C/T]GAGACCCGATGTAWTCGCAGATGTGGCGGATGATCAACCGGACAGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Nonsense 624 928 11 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 705 1009 13 16
Genomic Location:
Chromosome 8 (position 30339995)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAGGTTCGCAGTAAAGGAATGAACCCTTTCGAAYGAGACCCGATGTA[T/A]TCGCAGATGTGGCGGATGATCAACCGGACAGGAGGAGCCGAAAACAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18043
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Essential Splice Site 650 928 11 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Essential Splice Site 731 1009 13 16
Genomic Location:
Chromosome 8 (position 30340074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGGAGCCGAAAACAACGTGGAGGAATCAAAAGAAGGCATCCGGARG[G/T]TAGGAGGCTYTAGCCGCTTTGACTACYGCCACCGTTTGTCTARTWACGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u7t04tpr