cyb561d1

Ensembl ID:
ENSDARG00000055295
ZFIN ID:
ZDB-GENE-040912-157
Description:
cytochrome b-561 domain containing 1 [Source:RefSeq peptide;Acc:NP_001004590]
Human Orthologue:
CYB561D1
Human Description:
cytochrome b-561 domain containing 1 [Source:HGNC Symbol;Acc:26804]
Mouse Orthologue:
Cyb561d1
Mouse Description:
cytochrome b-561 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919273]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38855 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077641 Nonsense 103 238 3 3
Genomic Location (Zv9):
Chromosome 11 (position 37255645)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36152873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGTCCGTTCTGCTTCAAGTCTCGCAAGTGGAAGGTTCGTCTGCACTG[G/A]TTTTTTCAGGCTCTACTGCTCATCTGCGGAGCCACAGGATTGGGCTTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link