mpeg1

Ensembl ID:
ENSDARG00000055290
ZFIN ID:
ZDB-GENE-030131-7347
Description:
macrophage expressed 1 [Source:RefSeq peptide;Acc:NP_997902]
Human Orthologue:
MPEG1
Human Description:
macrophage expressed 1 [Source:HGNC Symbol;Acc:29619]
Mouse Orthologues:
Mpeg1, Pfpl
Mouse Descriptions:
macrophage expressed gene 1 Gene [Source:MGI Symbol;Acc:MGI:1333743]
pore forming protein-like Gene [Source:MGI Symbol;Acc:MGI:1860266]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5487 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077637 Nonsense 103 718 1 2
ENSDART00000131988 None None 93 None 3
Genomic Location:
Chromosome 8 (position 30561317)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAAAAAGTGAGCGGAGTGGAGACAAACTCAGAGATCATCATGTCGTG[G/A]CTGGAACAGAAAAGCTCAAYTTCAAGCTCCGTTAATGCTGATGTTTCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x2trp3xf