LOC568356

Ensembl ID:
ENSDARG00000055284
Human Orthologue:
AFAP1
Human Description:
actin filament associated protein 1 [Source:HGNC Symbol;Acc:24017]
Mouse Orthologue:
Afap1
Mouse Description:
actin filament associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917542]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35294 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42030 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077580 Essential Splice Site 268 723 6 16
ENSDART00000130594 Essential Splice Site 273 807 6 17
Genomic Location (Zv9):
Chromosome 12 (position 24244187)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22773705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGACGGAGCTGGCTCTGGATCCACTGTTCACAAGGCAGAGCTGGAAAAG[G/A]TGCAATTTCATAATTATATTTATGGATAATACTTTCTGTGTGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077580 Nonsense 272 723 7 16
ENSDART00000130594 Nonsense 277 807 7 17
Genomic Location (Zv9):
Chromosome 12 (position 24244902)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22774420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCTATGGATATCTGAAACATTATTCTTGTTTTGCAGAAGCTGTCCTG[C/A]GATCGGCCCAGTTCAGATGGAGAGCCCTGCCATGAAAACGGCATCTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link