cfb

Ensembl ID:
ENSDARG00000055278
ZFIN ID:
ZDB-GENE-980526-487
Description:
complement factor B [Source:RefSeq peptide;Acc:NP_571413]
Human Orthologues:
CFB, XXbac-BPG116M5.17
Human Descriptions:
cDNA FLJ55673, highly similar to Complement factor B [Source:UniProtKB/TrEMBL;Acc:B4E1Z4]
complement factor B [Source:HGNC Symbol;Acc:1037]
Mouse Orthologue:
Cfb
Mouse Description:
complement factor B Gene [Source:MGI Symbol;Acc:MGI:105975]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23958 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14271 Nonsense Available for shipment Available now
sa1866 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa23958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077593 Essential Splice Site 91 761 2 18
ENSDART00000108763 Essential Splice Site 91 759 2 20
Genomic Location:
Chromosome 21 (position 26811085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGTCTGGACCCCAAAGGCCAGCTCTAGAAAAAAAGCTGAGTGCAAAA[G/A]TAAGAAATAGAGCTTCACTTTGTATCATTATATCATGAATAAATGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077593 Nonsense 311 761 7 18
ENSDART00000108763 Nonsense 311 759 7 20
Genomic Location:
Chromosome 21 (position 26812518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCRAACTATGAGATCYTGATGTTTGCRACGGATGTTGATCAGATAGTT[A/T]AAATGAGGGATTTCAAAACTAATGAAAAGGCAAGAAAMATCTYGAAGRTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1866
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077593 Nonsense 509 761 12 18
ENSDART00000108763 Nonsense 509 759 12 20
Genomic Location:
Chromosome 21 (position 26820949)
KASP Assay ID:
554-1857.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGCAGATCTCAGATTGCATGGGCTCGTTAGTTACCTCCCGGTATATCT[T/A]GACAGCAGCCCACTGTTTTAAAGAAGGAGACACACCKGATAAGATAACRG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3tyq76ed