rel

Ensembl ID:
ENSDARG00000055276
ZFIN ID:
ZDB-GENE-040718-255
Description:
v-rel reticuloendotheliosis viral oncogene homolog [Source:RefSeq peptide;Acc:NP_001001841]
Human Orthologue:
REL
Human Description:
v-rel reticuloendotheliosis viral oncogene homolog (avian) [Source:HGNC Symbol;Acc:9954]
Mouse Orthologue:
Rel
Mouse Description:
reticuloendotheliosis oncogene Gene [Source:MGI Symbol;Acc:MGI:97897]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16421 Nonsense Available for shipment Available now
sa16479 Nonsense Available for shipment Available now
sa4505 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22309 Nonsense Available for shipment Available now
sa6305 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077612 Nonsense 118 596 5 10
ENSDART00000077612 Nonsense 118 596 5 10
Genomic Location:
Chromosome 13 (position 26040331)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTTTATTTGTTTYTTTTTCTTTAAACAGTTTTCAGAATCTGGGCATC[C/T]AGTGTGTGCGGAGAAGAGAAGTGAAGGATGCCATCATGCAGAGGGTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077612 Nonsense 118 596 5 10
ENSDART00000077612 Nonsense 118 596 5 10
Genomic Location:
Chromosome 13 (position 26040331)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTTTATTTGTTTYTTTTTCTTTAAACAGTTTTCAGAATCTGGGCATC[C/T]AGTGTGTGCGGAGAAGAGAAGTGAAGGATGCCATCATGCAGAGGGTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077612 Essential Splice Site 296 596 8 10
Genomic Location:
Chromosome 13 (position 26022260)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGGTCAGTGAGCCCATGGAGTTCAGATACCTGCCTGATGACAAAGG[T/G]AAATAATAATAAGAAGAATAWTTTTKACACTTATTATTTATTGGATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077612 Nonsense 458 596 10 10
Genomic Location:
Chromosome 13 (position 26020089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCAACCGGCAACCAGCCTCGACAGGACCTACTAAACCAGCAGGTTCAG[C/T]AATCCCAACAGCCACCACAAAGACAAGGACAGGAAGGAGCCTGGTATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077612 Nonsense 538 596 10 10
Genomic Location:
Chromosome 13 (position 26019848)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGAAACAGGAACCTCAAGGGCTGAGCAACATGGCTCCATTGGKCAACT[C/A]GGATTGTGTACAGTCCTTCACAGCCCTCCTAAACTGCAACAATGGAAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Celiac disease: Multiple common variants for celiac disease influencing immune gene expression. (View Study)
  • Crohn's disease: A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Hodgkin's lymphoma: A genome-wide association study of Hodgkin's lymphoma identifies new susceptibility loci at 2p16.1 (REL), 8q24.21 and 10p14 (GATA3). (View Study)
  • Psoriasis: A genome-wide association study identifies new psoriasis susceptibility loci and an interaction between HLA-C and ERAP1. (View Study)
  • Psoriatic arthritis: Genome-wide meta-analysis of psoriatic arthritis identifies susceptibility locus at REL. (View Study)
  • Rheumatoid arthritis: Genome-wide association study meta-analysis identifies seven new rheumatoid arthritis risk loci. (View Study)
  • Rheumatoid arthritis: REL, encoding a member of the NF-kappaB family of transcription factors, is a newly defined risk locus for rheumatoid arthritis. (View Study)
  • Ulcerative colitis: Genome-wide association identifies multiple ulcerative colitis susceptibility loci. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nxrc9nvf