im:7149628

Ensembl ID:
ENSDARG00000055270
ZFIN ID:
ZDB-GENE-050309-123
Description:
Im:7149628 protein [Source:UniProtKB/TrEMBL;Acc:Q58EM5]
Human Orthologue:
MSRA
Human Description:
methionine sulfoxide reductase A [Source:HGNC Symbol;Acc:7377]
Mouse Orthologue:
Msra
Mouse Description:
methionine sulfoxide reductase A Gene [Source:MGI Symbol;Acc:MGI:106916]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42948 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077608 Nonsense 137 237 4 6
Genomic Location (Zv9):
Chromosome 17 (position 27220297)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 27344413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTTCTCTCCCAAAGATGTCAGCTTGGAGAAACTTCTCAAAGTCTTCT[G/A]GGAAAGCCACGACCCCACTCAAGGTCAGCAAACACACCTATTTCCTCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Adiposity: Genome-wide association scan meta-analysis identifies three Loci influencing adiposity and fat distribution. (View Study)
  • Alzheimer's disease: Alzheimer disease pathology in cognitively healthy elderly: a genome-wide study. (View Study)
  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Schizophrenia: A genome-wide association study for quantitative traits in schizophrenia in China. (View Study)
  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)
  • Systolic blood pressure: Genome-wide association study of blood pressure and hypertension. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link