LOC100332732

Ensembl ID:
ENSDARG00000055255
Human Orthologues:
PITPNB, PITPNM3
Human Descriptions:
phosphatidylinositol transfer protein, beta [Source:HGNC Symbol;Acc:9002]
PITPNM family member 3 [Source:HGNC Symbol;Acc:21043]
Mouse Orthologue:
Pitpnb
Mouse Description:
phosphatidylinositol transfer protein, beta Gene [Source:MGI Symbol;Acc:MGI:1927542]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42559 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077582 Nonsense 869 947 19 20
Genomic Location (Zv9):
Chromosome 15 (position 26020125)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26750908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCCTGCAGTTCAGTCACAGAGCTCGTCCCAAGAAGAGCTCATCGGTG[C/T]GAATGGTGCTTCGAAAGGGCTCATTCGGTTTGTCGGCTAAACCAGACTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link