si:ch211-132b12.8

Ensembl ID:
ENSDARG00000055250
ZFIN ID:
ZDB-GENE-030131-5453
Description:
hypothetical protein LOC561391 [Source:RefSeq peptide;Acc:NP_001038424]
Human Orthologues:
CCNA1, CCNA2
Human Descriptions:
cyclin A1 [Source:HGNC Symbol;Acc:1577]
cyclin A2 [Source:HGNC Symbol;Acc:1578]
Mouse Orthologues:
Ccna1, Ccna2
Mouse Descriptions:
cyclin A1 Gene [Source:MGI Symbol;Acc:MGI:108042]
cyclin A2 Gene [Source:MGI Symbol;Acc:MGI:108069]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23363 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077577 Essential Splice Site 280 398 7 9

The following transcripts of ENSDARG00000055250 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 38999648)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40712365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTCATTTTCTTCTCATCTCTGCCTCCATCGCACGCTGCAGTGACAAG[G/A]TCAGTTTACTTTAATTTGACCACCATTACCACTATTAAATGTCCCAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link