ENSDARG00000055245

Ensembl ID:
ENSDARG00000055245

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6945 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14429 Essential Splice Site Available for shipment Available now
sa17430 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077572 Essential Splice Site 16 445 1 10
ENSDART00000125685 None None 363 None 7
Genomic Location:
Chromosome 4 (position 19463613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATAGAGGAAATAAGATACAGTTTTTACCCCAGCTAACGTTTATCAAGG[T/G]AAATTTAATGTTGACATTTTATTTTCTGTATAAAGATACCTACATATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077572 Essential Splice Site 229 445 4 10
ENSDART00000125685 None None 363 None 7
Genomic Location:
Chromosome 4 (position 19465462)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGACAAYAACAGAACAGCTCACAGCAGYATCACATTACATGTGCAGTG[T/A]AGGACTTTTACTRYCATCTGTTCTCTTCTCCTCCAKAAGACACTYATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077572 None None 445 None 10
ENSDART00000125685 Splice Site, Nonsense 255 363 5 7
Genomic Location:
Chromosome 4 (position 19473266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATATCATTATGAAATATAWTTTATGTTKTGCATTTGTTTTCCCTCAGA[T/G]TCCCCTAAAAACACCTYAGTTTCTGTCTTTCCCTCTAACTCTGTGTTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8gxd147f