xdh

Ensembl ID:
ENSDARG00000055240
ZFIN ID:
ZDB-GENE-070719-9
Human Orthologue:
XDH
Human Description:
xanthine dehydrogenase [Source:HGNC Symbol;Acc:12805]
Mouse Orthologue:
Xdh
Mouse Description:
xanthine dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:98973]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7834 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12706 Essential Splice Site Available for shipment Available now
sa23125 Nonsense Mutation detected in F1 DNA During 2016
sa42968 Nonsense Mutation detected in F1 DNA During 2016
sa2937 Nonsense Mutation detected in F1 DNA During 2016
sa5632 Nonsense F2 line generated During 2016
sa14557 Nonsense Available for shipment Available now
sa36464 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42969 Nonsense Mutation detected in F1 DNA During 2016
sa9542 Nonsense Available for shipment Available now
sa4011 Nonsense Mutation detected in F1 DNA During 2016
sa36465 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Essential Splice Site 27 1351 1 36
Genomic Location:
Chromosome 17 (position 33546712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCAGTCTCCAGGGGATGACCTTGTCTTCTTCGTTAATGGAAAAAAGG[T/A]AAGGGGGGATTGAATAAGCATATTACATATCTCCAAGTGTTTCATAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Essential Splice Site 234 1351 8 36
Genomic Location:
Chromosome 17 (position 33552869)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCCACTGGACCCGACACAAGAGATTATTTTTCCACCTGAGCTTGTGG[T/A]GCRTATAAGAAGTTTAATTTKCATATTGGACYRTCATAGTAAACACAKCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 410 1351 13 36
Genomic Location:
Chromosome 17 (position 33555902)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGGGAGAAACGAGTTCTTGAAATGGATGACAAGTTCTTCACTGGTTA[T/A]CGTAAGACTGCTTTGAAGCCAGAGGAGATTCTTTTGTCCATTGAGATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 470 1351 14 36
Genomic Location:
Chromosome 17 (position 33556406)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGATGAATGTATATTTCAAGGAGCAATCCAATACAGTACAGAGTATC[C/T]GAATAAGCTATGGAGGAATGGCCCCTGTCACTGTTCTTGCTACGGCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 507 1351 15 36
ENSDART00000077553 Nonsense 507 1351 15 36
Genomic Location:
Chromosome 17 (position 33556610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAKTGCAGGCAATGGAATGAAGATCTTCTTGAGGAAGCCTGCAGCTCAT[T/A]GGCTGAGGAGATGAGTCTATCTCCCTCAGCTCCGGGTGGGATGGTGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5632
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 507 1351 15 36
ENSDART00000077553 Nonsense 507 1351 15 36
Genomic Location:
Chromosome 17 (position 33556610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAKTGCAGGCAATGGAATGAAGATCTTCTTGAGGAAGCCTGCAGCTCAT[T/A]GGCTGAGGAGATGAGTCTATCTCCCTCAGCTCCGGGTGGGATGGTGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 763 1351 21 36
Genomic Location:
Chromosome 17 (position 33564752)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNNNNNNNNATTCTATAGGTGAGATGCACATTGGAGGGCAGGAA[C/T]AGTTTTATCTGGAGACTAACTGCACRCTGGCTGTCCCTCGTGGAGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Essential Splice Site 795 1351 21 36
Genomic Location:
Chromosome 17 (position 33564852)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAAATGGAGCTGTTTGTGTCCACACAGTCGGCCTCCAAGACACAAG[T/A]AAATACACAAAACATTCAGTCTTTTAGGATTTAGTGTAGGATAGTAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 811 1351 22 36
Genomic Location:
Chromosome 17 (position 33565162)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCTCTGGTGGCTAAAGCTTTAGGTGTTCCTGCTAATCGGGTGGTGTG[T/A]CGTGTGAAGAGAATGGGTGGAGGATTTGGAGGGAAAGAGAGTCGGAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 868 1351 23 36
Genomic Location:
Chromosome 17 (position 33565420)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAGGACWTGCTGGTCACAGGTGGCCGCCATCCTTTCTTTGGACAGTA[C/A]AAGGTAAAAGTATATACAAGTTAACCAGATAYTGTCCWTGTCCTGATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 911 1351 25 36
Genomic Location:
Chromosome 17 (position 33567913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAATACACAGATCCTGGAGAGGGCGCTGTTYCACATGGATAACTCCTA[C/A]AACATTCCTAACATTTGTGGCACAGGCTACATGTGTAAAACCAACCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 1242 1351 34 36
Genomic Location:
Chromosome 17 (position 33576541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTGTTCACGCTAGAGGAACTTCGCTACTCTCCTGACGGTTACCTATA[T/G]ACTCGTGGACCTGGCATGTATAAGATTCCTGCTTTTGGGGATATTCCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link