kif17

Ensembl ID:
ENSDARG00000055238
ZFIN ID:
ZDB-GENE-080724-12
Description:
Homomeric kinesin Kif17 [Source:UniProtKB/TrEMBL;Acc:C0L098]
Human Orthologue:
KIF17
Human Description:
kinesin family member 17 [Source:HGNC Symbol;Acc:19167]
Mouse Orthologue:
Kif17
Mouse Description:
kinesin family member 17 Gene [Source:MGI Symbol;Acc:MGI:1098229]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18340 Nonsense Available for shipment Available now
sa9256 Nonsense Mutation detected in F1 DNA During 2014
sa12627 Nonsense Available for shipment Available now
sa256 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129918 Nonsense 92 823 2 14
Genomic Location:
Chromosome 11 (position 38819468)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTACAGGGTGTAACTGAGGGCTACAAKGGGACCATTTTTGCTTATGGA[C/T]AAACAGGCAGCGGCAARTCGTTTACAATGCAAGGTGTACCAGATCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129918 Nonsense 439 823 7 14
Genomic Location:
Chromosome 11 (position 38834527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCYGARCAAGAGTCTAAAGKCAAACTCCAGGAGGACATCGCTGCCTTG[A/T]GAACATCATATGAGACYAGGCTCTCTTCTTTAGAAAGGTCCAGAGGTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129918 Nonsense 442 823 7 14
Genomic Location:
Chromosome 11 (position 38834538)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTCTAAAGKCAAACTCCAGGAGGACATCGCTGCCTTGWGAACATCATA[T/A]GAGACYAGGCTCTCTTCTTTAGAAAGGTCCAGAGGTAGTCRAACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129918 Nonsense 553 823 10 14
ENSDART00000129918 Nonsense 553 823 10 14
Genomic Location:
Chromosome 11 (position 38836620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGGAGTTTGTGGGTGGCGAGCAGGTGAGGAACGAGGAGCTCAAGCAG[A/T]GACACAAACAGAGGAAGACTCTGGCCGACCAGAGGAAGAAGCAGCTGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lwfdwrt8