fancc

Ensembl ID:
ENSDARG00000055232
ZFIN ID:
ZDB-GENE-060510-2
Description:
Fanconi anemia, complementation group C [Source:RefSeq peptide;Acc:NP_001035727]
Human Orthologue:
FANCC
Human Description:
Fanconi anemia, complementation group C [Source:HGNC Symbol;Acc:3584]
Mouse Orthologue:
Fancc
Mouse Description:
Fanconi anemia, complementation group C Gene [Source:MGI Symbol;Acc:MGI:95480]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11892 Nonsense Available for shipment Available now
sa34431 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41234 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11892
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077554 Nonsense 47 518 1 13
ENSDART00000099027 Nonsense 47 554 2 15
ENSDART00000130901 Nonsense 47 518 2 14

The following transcripts of ENSDARG00000055232 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 30965661)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30108387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTAGCAGACACCTTGGCCCTCTGAGAAACTTTCTCCAGCAAATTCTG[C/T]AGGGGTTGCAGCAAATGGTAGGAAAATGTCTGAACATTMAGTTTCACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077554 Essential Splice Site 82 518 None 13
ENSDART00000099027 Essential Splice Site 82 554 None 15
ENSDART00000130901 Essential Splice Site 82 518 None 14

The following transcripts of ENSDARG00000055232 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 30973879)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30116605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCAGTTCCTGGGAAGACTATGTTGGAACTCATGTGTTACTGCGGACGG[T/A]AAATTTACGACTCTTCTACACTTGGGGGTGTGTTTCCTATTTGAGACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077554 Essential Splice Site 135 518 None 13
ENSDART00000099027 Essential Splice Site 171 554 None 15
ENSDART00000130901 Essential Splice Site 135 518 None 14

The following transcripts of ENSDARG00000055232 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 30985747)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30128473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGGAGGTTTCTAAAAGCTGTGACTGCTTGCCGAATGCATCAGCAAGG[T/C]AATAAAACTTTAACATCACTTTTGTATACAAATATGCAATTACATTTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link