dock8

Ensembl ID:
ENSDARG00000055225
ZFIN ID:
ZDB-GENE-060503-743
Description:
Novel protein similar to vertebrate dedicator of cytokinesis 8 (DOCK8) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
DOCK8
Human Description:
dedicator of cytokinesis 8 [Source:HGNC Symbol;Acc:19191]
Mouse Orthologue:
Dock8
Mouse Description:
dedicator of cytokinesis 8 Gene [Source:MGI Symbol;Acc:MGI:1921396]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13478 Essential Splice Site Available for shipment Available now
sa12347 Essential Splice Site Available for shipment Available now
sa12014 Nonsense Available for shipment Available now
sa21325 Nonsense Available for shipment Available now
sa34432 Nonsense Mutation detected in F1 DNA During 2017
sa30642 Nonsense Mutation detected in F1 DNA During 2017
sa8963 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099021 Essential Splice Site 54 2090 3 48
ENSDART00000137583   None 189 None 5
ENSDART00000144637   1 2034 1 46
Genomic Location (Zv9):
Chromosome 8 (position 31243932)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30386658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATACTTTTCACTACTTGCTTTTGATATTATGATGTGGTTTTCTTTCT[A/C]GYCTCAATCATATGAAGCGGTTGAGCCRGTGGACCTGGATGAGTTCCKGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099021 Essential Splice Site 294 2090 8 48
ENSDART00000137583   None 189 None 5
ENSDART00000144637 Essential Splice Site 241 2034 6 46
Genomic Location (Zv9):
Chromosome 8 (position 31234673)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30377399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCTCTTTGCAACAATGGCCCTCTATGACCTGAAGGAGAAGAAGAAGG[T/G]CAGTTTCTGATGGTTACTTTAWAAGCTAAGAATAAAATTACAAATATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099021 Nonsense 872 2090 22 48
ENSDART00000137583   None 189 None 5
ENSDART00000144637 Nonsense 816 2034 20 46
Genomic Location (Zv9):
Chromosome 8 (position 31219967)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30362693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTGTTTATCTACCAGGTACAGGAGGTCTGATGGCTCATCCAGAGGGT[C/T]GATACAGCACTTTAACTCGCACAACGGCCACCACTGTTGGCTTCATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099021 Nonsense 1456 2090 35 48
ENSDART00000137583   None 189 None 5
ENSDART00000144637 Nonsense 1400 2034 33 46
Genomic Location (Zv9):
Chromosome 8 (position 31204252)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30346978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGCAGTTCCTCTGGCCGACTGTAAGGATAATGTGGTTGGCGGAGTGT[T/A]GAAGGTTTTGCTGCACTCGCTCACCTGTAATCAGAGCACCACCTACTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099021 Nonsense 1615 2090 38 48
ENSDART00000137583   None 189 None 5
ENSDART00000144637 Nonsense 1559 2034 36 46
Genomic Location (Zv9):
Chromosome 8 (position 31191697)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30334423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTATCCTCTCAGATACAGTCAAGATGAAGGAGTTCCAGAAAGATCCC[G/T]AGATGCTTATGGACCTCATGTATAGGTACACAGCTAAACCCAAGTCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099021 Nonsense 1858 2090 44 48
ENSDART00000137583   None 189 None 5
ENSDART00000144637 Nonsense 1802 2034 42 46
Genomic Location (Zv9):
Chromosome 8 (position 31187036)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30329762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTGTGACAAAATGTGTTGATTTTTGCATTTCACACCAGGCGTACATA[C/T]AGATCACCTTTGTGGAGCCTTACTTTGACGACTATGAGATGAAAGACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099021 Essential Splice Site 1934 2090 45 48
ENSDART00000137583 Essential Splice Site 37 189 2 5
ENSDART00000144637 Essential Splice Site 1878 2034 43 46
Genomic Location (Zv9):
Chromosome 8 (position 31183969)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30326695
KASP Assay ID:
2260-0768.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTAGGATGATGWATACAAAAANTGAATTTTCTCTCTTGACATGTTTTCA[G/A]TTTGACCTCACACCAATCGAGGTGGCCATTGAGGACATGCAGAAGAAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link