ABLIM2

Ensembl ID:
ENSDARG00000055223
Description:
actin binding LIM protein family, member 2 [Source:HGNC Symbol;Acc:19195]
Human Orthologue:
ABLIM2
Human Description:
actin binding LIM protein family, member 2 [Source:HGNC Symbol;Acc:19195]
Mouse Orthologue:
Ablim2
Mouse Description:
actin-binding LIM protein 2 Gene [Source:MGI Symbol;Acc:MGI:2385758]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35293 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17492 Nonsense Available for shipment Available now
sa17496 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077548 Essential Splice Site 277 615 8 19
Genomic Location:
Chromosome 12 (position 24133349)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCATCCTCCTTGCAGACAGGCAGCGCGTATGGAGGAGAAGAGCAAGG[T/C]AAAACTAACTGTAAAACTATCAGGTGATACAATACAAATGCCAAATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077548 Nonsense 474 615 13 19
Genomic Location:
Chromosome 12 (position 24141727)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCACTACTCTGGCTTTACTCCAGCAGCACAACTACATCCCTTACTTC[A/T]GAGGTACCACAGCTTTGCCWGCAGGYCTTTGCCAGTACCAATTTATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077548 Nonsense 611 615 19 19
Genomic Location:
Chromosome 12 (position 24158879)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTAGGCAGCTGATCTTGGTGAGGATGAGRCAGACCATGATTCATCCT[G/A]GAGTGGAATGAGAGGTGANNNNNNGTTTGACTTATAGACCATAAATAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link