ABLIM2

Ensembl ID:
ENSDARG00000055223
Description:
actin binding LIM protein family, member 2 [Source:HGNC Symbol;Acc:19195]
Human Orthologue:
ABLIM2
Human Description:
actin binding LIM protein family, member 2 [Source:HGNC Symbol;Acc:19195]
Mouse Orthologue:
Ablim2
Mouse Description:
actin-binding LIM protein 2 Gene [Source:MGI Symbol;Acc:MGI:2385758]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17492 Nonsense Available for shipment Available now
sa17496 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077548 Nonsense 474 615 13 19
Genomic Location:
Chromosome 12 (position 24141727)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCACTACTCTGGCTTTACTCCAGCAGCACAACTACATCCCTTACTTC[A/T]GAGGTACCACAGCTTTGCCWGCAGGYCTTTGCCAGTACCAATTTATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077548 Nonsense 611 615 19 19
Genomic Location:
Chromosome 12 (position 24158879)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTAGGCAGCTGATCTTGGTGAGGATGAGRCAGACCATGATTCATCCT[G/A]GAGTGGAATGAGAGGTGANNNNNNGTTTGACTTATAGACCATAAATAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sh6jao27