dtnbp1b

Ensembl ID:
ENSDARG00000055206
ZFIN ID:
ZDB-GENE-060503-889
Description:
dystrobrevin binding protein 1b [Source:RefSeq peptide;Acc:NP_001038279]
Human Orthologue:
DTNBP1
Human Description:
dystrobrevin binding protein 1 [Source:HGNC Symbol;Acc:17328]
Mouse Orthologue:
Dtnbp1
Mouse Description:
dystrobrevin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2137586]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17933 Essential Splice Site Available for shipment Available now
sa11373 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104008 Essential Splice Site 68 216 2 4
Genomic Location (Zv9):
Chromosome 19 (position 26658711)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26588823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTGGAGCACTACCTGTCCACTGGATACCTACAGMTTGCAGAGAGGAGAGG[T/C]AAGATATGCCTTCAGTTYAAGTCTGAATCAKATATACCAAATGTTTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104008 Essential Splice Site 116 216 3 4
Genomic Location (Zv9):
Chromosome 19 (position 26650550)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26580662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCAATTCTGGAGGCGAAGACAACAGYGTGGCCTCRCCAATGCTTGG[T/C]ATACATTCATATAGTGACATTTACCAATCATCAAGCAATGCATTTACCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link