ccr9a

Ensembl ID:
ENSDARG00000055186
ZFIN ID:
ZDB-GENE-060130-125
Description:
Novel protein similar to vertebrate chemokine (C-C motif) receptor 9 (CCR9) [Source:UniProtKB/TrEMBL
Human Orthologues:
CCR9, CXCR6
Human Descriptions:
chemokine (C-C motif) receptor 9 [Source:HGNC Symbol;Acc:1610]
chemokine (C-X-C motif) receptor 6 [Source:HGNC Symbol;Acc:16647]
Mouse Orthologues:
Ccr9, Cxcr6
Mouse Descriptions:
chemokine (C-C motif) receptor 9 Gene [Source:MGI Symbol;Acc:MGI:1341902]
chemokine (C-X-C motif) receptor 6 Gene [Source:MGI Symbol;Acc:MGI:1934582]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32955 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077511 Nonsense 174 369 3 3
Genomic Location (Zv9):
Chromosome 2 (position 32515752)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32814659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAAGAGAAGTCGTCTCCTGTACAGTAAGCTCATCTGTGTGTTAGTCT[G/A]GCTGCTGGCAGCCCTGATGTCCATTCCAGAGTGTCTATTCGCTCGATCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link