etv1

Ensembl ID:
ENSDARG00000055183
ZFIN ID:
ZDB-GENE-070104-1
Description:
Etv1 protein [Source:UniProtKB/TrEMBL;Acc:B3DIF9]
Human Orthologue:
ETV1
Human Description:
ets variant 1 [Source:HGNC Symbol;Acc:3490]
Mouse Orthologues:
Etv1, Gm5454
Mouse Descriptions:
ets variant gene 1 Gene [Source:MGI Symbol;Acc:MGI:99254]
predicted gene 5454 Gene [Source:MGI Symbol;Acc:MGI:3648286]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14953 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012658 Nonsense 264 476 7 12
Genomic Location:
Chromosome 15 (position 31685087)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTACACACACTCCWTGATGATCAAACAAGAGCCGCGCGACTTCACCTA[C/A]GACTCAGGTGAGACGACGACATTAAACATAACACACTTTCNNNNNNNNNN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4hbrrvqw