ENSDARG00000055172

Ensembl ID:
ENSDARG00000055172
Human Orthologue:
ASRGL1
Human Description:
asparaginase like 1 [Source:HGNC Symbol;Acc:16448]
Mouse Orthologue:
Asrgl1
Mouse Description:
asparaginase like 1 Gene [Source:MGI Symbol;Acc:MGI:1913764]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25249 Nonsense Mutation detected in F1 DNA During 2014
sa8116 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20006 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123612 Nonsense 221 1574 2 3
Genomic Location:
Chromosome 3 (position 25260801)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGACCCATCCATTGTTTGTGGTCTGTCTTCTCTAAATCGTCAAGCCTG[G/A]CATTCTGTAAGAATGGACATCTTAAAGGCAGGCGGAGAAGCTGCAGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123612 Essential Splice Site 283 1574 3 3
Genomic Location:
Chromosome 3 (position 25262018)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTAGAAATAATTGGCRGAATGATAAACATATTTGTATCTTCTTYAACA[G/T]GTGGTKAACTTRGTGGTGTTTAAAGATGGCCAAGCAGGTATGCTGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123612 Nonsense 824 1574 3 3
Genomic Location:
Chromosome 3 (position 25263642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGCAAGTTAGCAGCAGCCACTTCCACTGGGGGTTTAGTTGGCAAGTGG[A/T]AGGGCAGAGTTGGTGACACTGCAATAGTGGGAGCAGGAATATATGCTGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n9xrb01t