epo

Ensembl ID:
ENSDARG00000055163
ZFIN ID:
ZDB-GENE-061218-3
Description:
Erythropoietin [Source:UniProtKB/Swiss-Prot;Acc:Q2XNF5]
Human Orthologue:
EPO
Human Description:
erythropoietin [Source:HGNC Symbol;Acc:3415]
Mouse Orthologue:
Epo
Mouse Description:
erythropoietin Gene [Source:MGI Symbol;Acc:MGI:95407]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40873 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020288   None 182 None 5
ENSDART00000077483 Essential Splice Site None 171 1 6
ENSDART00000111066   None 183 None 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 23086770)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21651955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAGCCTCAAACGTCCCGATCCACTCCCTGGAGCCCAGGAATGAATCAG[G/T]TTTGTCTCCTATTTCCACCAAAGTCTGCTGTATTTCGGAAATACTTGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link