LOC565474

Ensembl ID:
ENSDARG00000055160
Human Orthologue:
CHADL
Human Description:
chondroadherin-like [Source:HGNC Symbol;Acc:25165]
Mouse Orthologue:
Chadl
Mouse Description:
chondroadherin-like Gene [Source:MGI Symbol;Acc:MGI:3036284]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5201 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5201
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055438 Nonsense 28 791 1 9
Genomic Location:
Chromosome 3 (position 25219874)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAATGATGTCTGTGGGTCAGACTCTGAAGTGTCCGCGTGTCTGCGTCTG[T/A]GACAACACAAAGCTCACWGTGAAGTGCATAGGGAAKAATCTCACACACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gvf96j2t