prox1

Ensembl ID:
ENSDARG00000055158
ZFIN ID:
ZDB-GENE-980526-397
Description:
prospero homeobox protein 1 [Source:RefSeq peptide;Acc:NP_571480]
Human Orthologue:
PROX1
Human Description:
prospero homeobox 1 [Source:HGNC Symbol;Acc:9459]
Mouse Orthologue:
Prox1
Mouse Description:
prospero-related homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:97772]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23124 Nonsense Available for shipment Available now
sa23123 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061487 Nonsense 625 739 4 5
ENSDART00000077476 Nonsense 625 739 4 5
Genomic Location (Zv9):
Chromosome 17 (position 33053555)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32895286
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTTTTCTCATAGTTTAACCGCTGCATCACATCCCAGCTGATCAAGT[G/A]GTTCAGCAACTTCCGCGAGTTCTACTACATCCAGATGGAGAAATTTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061487 Nonsense 709 739 5 5
ENSDART00000077476 Nonsense 709 739 5 5
Genomic Location (Zv9):
Chromosome 17 (position 33028987)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32870718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGTTTTTCAATGCCATTGTGGCAGGCAAAGATGTTGATCCTTCCTGG[A/T]AGAAGGCCATATACAAGGTCATCTGCAAGCTGGACAGTGAGGTCCCAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link