si:dkey-101k6.5

Ensembl ID:
ENSDARG00000055136
ZFIN ID:
ZDB-GENE-081105-143
Description:
Novel protein similar to vertebrate transforming growth factor, beta receptor II (70/80kDa) (TGFBR2)
Human Orthologue:
TGFBR2
Human Description:
transforming growth factor, beta receptor II (70/80kDa) [Source:HGNC Symbol;Acc:11773]
Mouse Orthologue:
Tgfbr2
Mouse Description:
transforming growth factor, beta receptor II Gene [Source:MGI Symbol;Acc:MGI:98729]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9311 Nonsense Mutation detected in F1 DNA During 2017
sa41488 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077446 Nonsense 183 590 4 7
ENSDART00000131738 Nonsense 156 518 3 6
Genomic Location (Zv9):
Chromosome 9 (position 39626593)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38764489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGTATCGCACACGTCAGCCAGGCAAAAAGCCCAAGGAATGGGGACMA[C/T]GACGGACCCACTACCAGTCTCTTGATCCTGCCGAGGGCCAAGCTAATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077446 Essential Splice Site 412 590 5 7
ENSDART00000131738 Essential Splice Site 385 518 4 6
Genomic Location (Zv9):
Chromosome 9 (position 39620185)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38758081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTAATTCAATTTGAGGAAGTTTCGAATCACATGGTCTGTGTTCGTCTA[G/T]GTGGGAACTGCCCGCTATATGGCCCCAGAAGTTCTGGAGTCCAGGGTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Migraine: Genome-wide association analysis identifies susceptibility loci for migraine without aura. (View Study)
  • Tonometry: Framingham Heart Study 100K Project: genome-wide associations for blood pressure and arterial stiffness. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link