si:ch211-152h14.2

Ensembl ID:
ENSDARG00000055133
ZFIN ID:
ZDB-GENE-080917-16
Human Orthologue:
CENPF
Human Description:
centromere protein F, 350/400kDa (mitosin) [Source:HGNC Symbol;Acc:1857]
Mouse Orthologue:
Cenpf
Mouse Description:
centromere protein F Gene [Source:MGI Symbol;Acc:MGI:1313302]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12296 Nonsense Available for shipment Available now
sa23122 Essential Splice Site Available for shipment Available now
sa11610 Nonsense Available for shipment Available now
sa36462 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39168 Nonsense Mutation detected in F1 DNA During 2017
sa10281 Nonsense Available for shipment Available now
sa23121 Essential Splice Site, Missense Available for shipment Available now
sa28888 Nonsense Mutation detected in F1 DNA During 2017
sa28887 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa36461 Nonsense Mutation detected in F1 DNA During 2017
sa12055 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12296
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Nonsense 256 1737 5 18
ENSDART00000087589 Nonsense 256 2861 5 26
ENSDART00000128418   None 953 None 13
ENSDART00000135517   None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32946069)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32787800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCTCTGGGATGCCGTGGTCTTATGATGACACACCAATAAAACCCCAY[C/T]AGCAGTTCACATCAGGCGCACCGAGTGACACAGTTGGATCACAGCAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Essential Splice Site 433 1737 8 18
ENSDART00000087589 Essential Splice Site 433 2861 8 26
ENSDART00000128418 Essential Splice Site 415 953 9 13
ENSDART00000135517   None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32944490)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32786221
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCAAGCCAAAAAAGACCACAATGTTTTGCAATCAGAAATGGATAAGG[T/C]AATTTAATGTGGCATTTCTTTCTTTCTTTCTAGTTTCAAACATTATACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11610
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Nonsense 899 1737 12 18
ENSDART00000087589 Nonsense 994 2861 11 26
ENSDART00000128418   None 953 None 13
ENSDART00000135517   None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32942472)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32784203
KASP Assay ID:
2261-1277.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAAAAACTGCATGATGCTGWTTGCCAAGAGAATGCAAATCATCTTAAA[G/T]AGATTTCCATARTGACAGAAGCACTTGCTGAAAAAGATGCCATGGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444   None 1737 None 18
ENSDART00000087589 Essential Splice Site 1051 2861 12 26
ENSDART00000128418   None 953 None 13
ENSDART00000135517   None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32942287)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32784018
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTTGACTCTTCTGTAGAGCTAATTTCGAGTCTGGAAAAAAAATTGCA[T/G]GACATGTCTGATGAAAAATCTTTATTAGAGATCAGTATCAAGGAGCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444   None 1737 None 18
ENSDART00000087589 Nonsense 1187 2861 12 26
ENSDART00000128418   None 953 None 13
ENSDART00000135517   None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32941878)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32783609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCTCTGTCTGATTTGAAAAACCAAGAAGCAGCAAAGTCCTGTGAGATT[G/T]AAACTTTGAAAGAAAAACTTCAGAAGGCTCAGTCTGAGCATGCTAAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Nonsense 1038 1737 14 18
ENSDART00000087589 Nonsense 1256 2861 12 26
ENSDART00000128418   None 953 None 13
ENSDART00000135517   None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32941670)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32783401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACAAGTAGAGGAGCTGCAAGGCAACGTTAGCATTCTTGAAGCAAAAT[T/A]AAGTGAGAGTGAGGCCCAGAGGTCCAACCTAGAATCAAAGCTTGAATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Essential Splice Site 1039 1737 15 18
ENSDART00000087589 Missense 1305 2861 12 26
ENSDART00000128418   None 953 None 13
ENSDART00000135517   None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32941524)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32783255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTTGTTTGGAGGAATCCCAGAAGGAACAACAGTCTCGTTCTGTATTA[G/A]TTGCTGAGTTGGAGTCTCTCCGTGTAATCCATGAACAACTAAAAGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Nonsense 1270 1737 15 18
ENSDART00000087589 Nonsense 1536 2861 12 26
ENSDART00000128418   None 953 None 13
ENSDART00000135517   None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32940831)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32782562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGCCAAACTAAAAGAAGAAAAGCAGCACACAGAGATCTTGTCCTCG[C/T]AGCTGGAGGCAACCATGCAACAACTGCAAGAATTAGACATTGCATCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444   None 1737 None 18
ENSDART00000087589 Nonsense 2314 2861 16 26
ENSDART00000128418   None 953 None 13
ENSDART00000135517 Splice Site None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32937140)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32778871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACTTGATGCTATGAAGCTGATGAACGTTGAACTTACGGGAAAGGTAT[T/A]ATTTTTTTCCCCATCACCTTTAATGGTTTTTAATTTCTCCCCTCACATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444   None 1737 None 18
ENSDART00000087589 Nonsense 2340 2861 17 26
ENSDART00000128418   None 953 None 13
ENSDART00000135517 Nonsense 91 562 2 8
Genomic Location (Zv9):
Chromosome 17 (position 32937040)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32778771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGTCACATATATTGATTGATATTTGTTAATTTTCAGTTAAATTCGCTA[C/T]AAGAGAGCAGTTTGCATCTTGAGACACAACATAAGCAAGAGCTATGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12055
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444   None 1737 None 18
ENSDART00000087589 Nonsense 2381 2861 17 26
ENSDART00000128418   None 953 None 13
ENSDART00000135517 Nonsense 132 562 2 8
Genomic Location (Zv9):
Chromosome 17 (position 32936917)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32778648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGATTAATCAGAATCTTTTGACTTGTCAGCTGCAGGAGTCTCAAAAA[C/T]AAATTGAAGARTATAAGGTAAGAATATTCTTCACCATATTTTACTCTGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link