ARMC4

Ensembl ID:
ENSDARG00000055128
Description:
armadillo repeat containing 4 [Source:HGNC Symbol;Acc:25583]
Human Orthologue:
ARMC4
Human Description:
armadillo repeat containing 4 [Source:HGNC Symbol;Acc:25583]
Mouse Orthologue:
Armc4
Mouse Description:
armadillo repeat containing 4 Gene [Source:MGI Symbol;Acc:MGI:1922184]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9510 Nonsense Available for shipment Available now
sa42032 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8644 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077453 Nonsense 604 1047 12 19
Genomic Location:
Chromosome 12 (position 24418002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGGAGTTGTTGGACTGTGTGCCTGCRGGAGAGTCTCTGARTCTGGAG[C/T]AGCAGAGGGATGTGGAGGTGGCTCGCTGTGGGGCTCTGGCTCTCTGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077453 Essential Splice Site 835 1047 15 19
Genomic Location:
Chromosome 12 (position 24399920)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTCACGAAGGCCGTTGGCGCCTGCGCCACTGACCCCGAGAACATGATG[T/A]GAGTGTCTAAGATGGATTGAGTCTTGAATATGTCAAATAATATCACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077453 Nonsense 988 1047 18 19
Genomic Location:
Chromosome 12 (position 24386780)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTACGATATCTTTACTCAAAAGATCCTTCAGTGCATCAAGCAAYAGCA[C/T]GAGCCCTGTTTGAGCTGTCTAAAGACCCCAAYAACTGCATCACCATGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link