ARMC4

Ensembl ID:
ENSDARG00000055128
Description:
armadillo repeat containing 4 [Source:HGNC Symbol;Acc:25583]
Human Orthologue:
ARMC4
Human Description:
armadillo repeat containing 4 [Source:HGNC Symbol;Acc:25583]
Mouse Orthologue:
Armc4
Mouse Description:
armadillo repeat containing 4 Gene [Source:MGI Symbol;Acc:MGI:1922184]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9510 Nonsense Available for shipment Available now
sa8644 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077453 Nonsense 604 1047 12 19
Genomic Location:
Chromosome 12 (position 24418002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGGAGTTGTTGGACTGTGTGCCTGCRGGAGAGTCTCTGARTCTGGAG[C/T]AGCAGAGGGATGTGGAGGTGGCTCGCTGTGGGGCTCTGGCTCTCTGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077453 Nonsense 988 1047 18 19
Genomic Location:
Chromosome 12 (position 24386780)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTACGATATCTTTACTCAAAAGATCCTTCAGTGCATCAAGCAAYAGCA[C/T]GAGCCCTGTTTGAGCTGTCTAAAGACCCCAAYAACTGCATCACCATGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x0g2tcgk