dtnbp1a

Ensembl ID:
ENSDARG00000055115
ZFIN ID:
ZDB-GENE-040426-1036
Description:
Dysbindin-A [Source:UniProtKB/Swiss-Prot;Acc:Q7ZWE6]
Human Orthologue:
DBNDD2
Human Description:
dysbindin (dystrobrevin binding protein 1) domain containing 2 [Source:HGNC Symbol;Acc:15881]
Mouse Orthologue:
Dbndd2
Mouse Description:
dysbindin (dystrobrevin binding protein 1) domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:10656

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36137 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077420 Essential Splice Site 54 362 3 10
ENSDART00000142062   None 206 None 4
ENSDART00000145825   None 270 None 6
ENSDART00000146479   None 187 None 4

The following transcripts of ENSDARG00000055115 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 27773010)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25618697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGAGTACCTTCCCCAATATTCTGCTGGAGTAGAATTACTCAGTCGG[T/C]AAGTCACTTTACTTTTTTATTAGTGAAATGTCAGTGGTGTCACGCTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link