pom121

Ensembl ID:
ENSDARG00000055113
ZFIN ID:
ZDB-GENE-030131-6557
Description:
Pom121 protein [Source:UniProtKB/TrEMBL;Acc:A9JR74]
Human Orthologues:
POM121, POM121C, POM121L2
Human Descriptions:
POM121 membrane glycoprotein C [Source:HGNC Symbol;Acc:34005]
POM121 membrane glycoprotein [Source:HGNC Symbol;Acc:19702]
POM121 membrane glycoprotein-like 2 [Source:HGNC Symbol;Acc:13973]
Mouse Orthologues:
Pom121, Pom121l2
Mouse Descriptions:
nuclear pore membrane protein 121 Gene [Source:MGI Symbol;Acc:MGI:2137624]
POM121 membrane glycoprotein-like 2 (rat) Gene [Source:MGI Symbol;Acc:MGI:2684870]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27646 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16901 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077426   None 136 None 2
ENSDART00000127805 Essential Splice Site 453 1201 7 13
Genomic Location (Zv9):
Chromosome 10 (position 36204569)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35237271
KASP Assay ID:
2260-3491.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTAAAACGGATAAGGTGGCAGCTGATCCTGACCCTTCTCCAAATACAA[G/A]TGAGAAAGAAAATTGAACAAGTCTACAAAATAATATAGTAGTATAATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077426   None 136 None 2
ENSDART00000127805 Nonsense 812 1201 11 13
Genomic Location (Zv9):
Chromosome 10 (position 36201549)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35234251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTGCTTCAACACCCGAGGTCAAACCCACCCAGCCCACCTTCAAGCCTT[T/A]ATTTGGCAGCACCACAATTAGTRGCRTTAGTGCATTCGGGCAGACCAYCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link